Chapter 6 Library preparation

Sequencing library preparation is a crucial step in the process of DNA sequencing. It involves the conversion of fragmented DNA molecules into a format that is compatible with the sequencing platform. The goal of library preparation is to create a collection of DNA fragments, each with sequencing adapters attached, which enables high-throughput sequencing of the DNA molecules. This process ensures that the genetic information contained in the DNA sample can be accurately and efficiently read by the sequencing instrument.

Most samples in the EHI are processed for shotgun metagenomics, which involves sequencing the genetic material of a complex mixture of organisms (e.g. host animal, bacteria, fungi, dietary remains). Adaptor-ligation based preparation is a common approach for creating sequencing libraries in shotgun metagenomics. Sequencing adapters are short DNA molecules with specific sequences that are compatible with the sequencing platform. The fragmented DNA and sequencing adapters are mixed together, and DNA ligase enzyme is used to covalently join the adapters to the ends of the DNA fragments. This creates DNA molecules with adapters on both ends.

6.1 Instruments, plasticware and reagents

Instruments

  • Thermocycler exclusively used as incubation equipment and not for amplification of DNA/RNA samples
  • Magnet compatible with 96-well plates such as 96S Super Magnet (Alpaca, SKU: A001322)
  • SAFE® Screw Cap De-/Capper (LVL technogies)
  • SAFE® 2D/1D Code Reader (LVL technogies)

Plasticware

Item Brand Catalogue number
96-well PCR plate, skirted/semi-skirted IST scientific ISTSIST-601-096GCT
Self-adhesive aluminium foil LVL technologies AF100Plus
PCR tube strips Axygen PCR-0208-AF-C
XSX 200 - 2D Biobanking Tubes LVL technologies 1C-X02-BL-CW-B-L

Stock reagents

Reagent Brand Catalogue number Storage
Deionized ultrapure water (ddH2O) Bionordika BN-51100 25 ºC
Absolute ethanol, EtOH 25 ºC
Elution Buffer (EB) Qiagen 19086 25 ºC
TWEEN® 20 Sigma-Aldrich P9416-50ML 25 ºC
BioUltra Poly(ethylene glycol) 400, PEG 4000 Sigma-Aldrich 95904-250G-F 25 ºC
Bovine Serum Albumin solution -20 ºC
BioUltra Sodium chloride solution ~5 M in H2O, NaCl Sigma-Aldrich 71386-1L 25 ºC
dNTPs set 100 mM -20 ºC
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S -20 ºC
T4 Polynucleotide Kinase (2,500 units) New England Biolabs M0201L -20 ºC
T4 DNA Polymerase 750 units New England Biolabs M0203L -20 ºC
T4 DNA ligase 100,000 units New England Biolabs M0202L -20 ºC
Bst 2.0 WarmStart® DNA Polymerase 8,000 units New England Biolabs M0538L -20 ºC
HighPrep™ PCR Clean-up System MAGBIO AC-60050 4 ºC
  • IS1 BEDC3 adapters: A*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T
  • IS2 BEDC3 adapters: G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T
  • IS3 BEDC3 adapters: A*G*A*T*CGGAA*G*A*G*C[C3spacer]

6.2 Preparation of working reagents

Reaction enhancer

  1. Combine the following reagents and mix them thoroughly
Reagent Stock concentration Mix concentration Volume per reaction
PEG 4000 50% 50% (w/v) 25% (w/v) 500 µl
BSA 20 mg/ml 2 mg/ml 100 µl
NaCl 5M 400 mM 80 µl
ddH2O 320 µl
Total 1000 µl

6.3 Protocol

1. End-repair reaction

  1. Pre-heat the thermocycler’s lid (set up/start incubation below).
  2. Create master mix according to the table below on a cooling block.
Reagent Stock concentration Mix concentration Volume per reaction
T4 DNA ligase buffer 10X 1X 3.00 µl
dNTPs 25 mM each 0.25 mM each 0.30 µl
T4 PNK 10 U/µl 7.5 U/rxn 0.75 µl
T4 DNA polymerase 3 U/µl 0.9 U/rxn 0.30 µl
Reaction enhancer 1.50 µl
Total 5.85 µl
  1. Mix the master mix by pipetting and spin it down.
  2. Add 5.85 µl of master mix to each well of PCR strips/PCR plate.
  3. Transfer 24 µl fragmented DNA to the wells (total reaction volume ca. 30 µl). Mix by pipetting.
  4. Quick-spin the PCR strips/PCR plate.
  5. Incubate: 30 min at 20°C followed by 30 min at 65°C, cool to 4°C.

2. Ligation reaction

  1. Pre-heat the thermocycler’s lid (set up/start incubation below).
  2. Create master mix according to the table below on a cooling block.
Reagent Stock concentration Mix concentration Volume per reaction
T4 DNA ligase buffer 10X 0.2X 0.75 µl
T4 DNA ligase 400 U/µl 300 U/rxn 0.75 µl
PEG 4000 50% 50% 6% 4.5 µl
Total 6.00 µl

  1. Transfer 1.5 µl of BEDC3 blunt-end adapters to each reaction and mix by pipetting. Use different adaptor molarities depending on the input DNA amount to avoid adaptor dimer peaks. 2 µM for extracts “Too low” 5 µM for <10 ng library input 10 µM for <50 ng library input 20 µM for <300 ng library input <- standard 50 µM for >300 ng library input

  2. Quick-spin the PCR strips/PCR plate.

  3. Add 6 µl of master mix to the wells (total reaction volume 37,5 µl). Mix by pipetting.

  4. Quick-spin the PCR strips/PCR plate.

  5. Incubate: 30 min at 20°C followed by 10 min at 65°C, cool to 4°C.

3. Fill-in reaction

  1. Pre-heat the thermocycler’s lid (set up/start incubation below).
  2. Create master mix according to the table below on a cooling block.
Reagent Stock concentration Mix concentration Volume per reaction
Isothermal Amp buffer 10X 0.33X 1.5 µl
dNTPs 25 mM 0.33 mM 0.76 µl
Bts 2.0 WarmStart polymerase 8 U/µl 9.6 U/rxn 1.2 µl
ddH2O 4.2 µl
Total 7.50 µl
  1. Mix the master mix by pipetting and spin it down.
  2. Add 7.5 µl of master mix to the wells (total reaction volume 45 µl). Mix by pipetting.
  3. Quick-spin the PCR strips/PCR plate.
  4. Incubate: 15 min at 65°C followed by 15 min at 80°C, cool to 4°C.
  5. Store PCR strips/PCR plate at -20° C if the magnetic beads purification is not performed on the same day.

4. Magnetic bead-based purification

The final indexed library product needs to be purified in order to get rid of the enzymes and buffers employed in the library preparation.

  1. Equilibrate the beads (MagBio or SPRI) to room temperature for 30 min.*
  2. Ensure the beads are fully resuspended by vortexing.
  3. Transfer 75 µl (1.67 times the volume) of beads to each well and mix thoroughly by pipetting.
  4. Incubate: 5 minutes at room temperature.
  5. Place PCR strips/PCR plate on a magnetic rack and wait until the supernatant is clear.
  6. Discard the supernatant.
  7. Add 200 µl of 80% EtOH to each well. Discard the supernatant.
  8. Repeat step 8. Ensure that all residual ethanol is removed.
  9. Dry the beads for a maximum of 5 minutes.
  10. Add 40 µl of EBT buffer to each well. Quick-spin the PCR strips/PCR plate.
  11. Incubate: 10 minutes at 37°C.
  12. Quick-spin the PCR strips/PCR plate.
  13. Place the PCR strips/PCR plate on a magnetic rack and wait until the supernatant is clear.
  14. Aspirate (slowly to avoid bead transfer) and dispense the supernatant (DNA libraries) to a new PCR strips/PCR plate.
  15. Place the PCR strips/PCR plate on a magnetic rack and wait until the supernatant is clear.
  16. Transfer the purified DNA to a 200 µl LVL tube.