Chapter 7 Library indexing
Truncated adapters lack some of the essential motifs for sequencing and demultiplexing. The second step of the adaptor-based library preparation is to amplify the library using primers containing unique identifiers and the flow cell binding sequence. This step serves the double function of increasing the molarity of the library to levels adequate for sequencing and assigning a sample-specific molecular tag to each library. As library preparation efficiency can be very variable when working with a diverse range of samples derived from different taxa, in the EHI pipeline we implement a qPCR screening that informs us about the optimal number of PCR cycles the libraries should be subject to for optimal library preparation.
It is crucial to carefully adjust the number of indexing PCR cycles to prevent the over-amplification of libraries, which can lead to the generation of highly clonal libraries. Each PCR cycle produces an identical copy of an existing DNA sequence. When libraries are excessively amplified, the resultant library could be predominantly composed of technical PCR duplicates rather than the original DNA sequence templates. Failure to appropriately calibrate this step might lead to sequencing only a fraction of the original sample’s complexity. This outcome could artificially distort the diversity of DNA molecules, potentially resulting in erroneous data interpretations.
7.1 Instruments, plasticware and reagents
Instruments
- Real Time PCR (qPCR) Instrument such as Mx3000 qPCR System (Agilent)
- Agarose Gel Electrophoresis System
- Thermocycler for amplification
- Magnet compatible with 96-well plates such as 96S Super Magnet (Alpaca, SKU: A001322)
- Fragment analysis system such as 5300 Fragment Analyzer system (Agilent) or 2100 Bioanalyzer (Agilent)
- SAFE® Screw Cap De-/Capper (LVL technogies)
- SAFE® 2D/1D Code Reader (LVL technogies)
Plasticware
Item | Brand | Catalogue number |
---|---|---|
qPCR Strips EU 8-tube strip, 0.1 mL (for qPCR) | BioPlastics | B72711 |
qPCR lids EU Optical Wide area 8-Cap Strip | BioPlastics | B57801 |
PCR tube strips | Axygen | PCR-0208-AF-C |
96-well PCR plate, skirted/semi-skirted such as | IST scientific | ISTSIST-601-096GCT |
Self-adhesive aluminium foil | LVL technologies | AF100Plus |
XSX 200 - 2D Biobanking Tubes | LVL technologies | 1C-X02-BL-CW-B-L |
Stock reagents
Reagent | Brand | Catalogue number | Storage |
---|---|---|---|
Deionised ultrapure water (ddH2O) | Bionordika | BN-51100 | 4 ºC |
Absolute ethanol, EtOH | 25 ºC | ||
Elution Buffer (EB) | Qiagen | 19086 | 25 ºC |
HighPrep™ PCR Clean-up System | MAGBIO | AC-60050 | 4 ºC |
AmpliTaq Gold™ DNA Polymerase with Buffer II and MgCl2 | Applied Biosystems | N8080241 | -20 ºC |
dNTPs mix 10 mM each | -20 ºC | ||
IS7 primer for qPCR: ACACTCTTTCCCTACACGAC | -20 ºC | ||
IS8 primer for qPCR: GTGACTGGAGTTCAGACGTGT | -20 ºC | ||
SYBR® Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSO | Invitrogen | S7563 | -20ºC |
BioReagent Dimethyl sulfoxide, DMSO | Sigma Aldrich | D2650-5X5ML | 25 ºC |
ROX Reference Dye | Invitrogen | 12223012 | -20 ºC |
- Basic reagents for agarose gel electrophoresis (2% Agarose solution, GelRed® nucleic acid dye, PBS buffer, 1Kb DNA ladder)
- P7 Index Primer: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT
- P5 Index Primer: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCT
7.2 Protocol
1. Library QC qPCR
Library preparation efficiency can vary significantly, especially when working with a diverse range of biological samples. This variation arises due to the presence of inhibitors, which differ greatly across taxa and sample types and can substantially reduce the enzymatic efficiency of the reactions. Measuring the concentration or molarity of the library product proves ineffective, as it encompasses measurements of target DNA with attached adaptors, DNA lacking attached adaptors, loose adaptors, and adaptor dimers. Consequently, this measurement does not offer meaningful insights into the library’s quality or effectiveness.
The most effective approach to evaluate library preparation quality involves conducting a qPCR assay utilising PCR primers that hybridise with the adaptors linked to the DNA molecules during the library preparation step. Within the qPCR assay, only DNA molecules with adaptors attached to both ends and adaptor dimers undergo amplification. Unlike traditional PCR, qPCR offers a real-time overview of the amplification pattern, which proves invaluable for assessing the ideal library quantity, identifying inhibitor presence, and estimating the optimal number of PCR cycles required for the subsequent indexing PCR step in the pipeline.
Although the amplification pattern itself cannot distinguish between library amplification and adaptor-dimer amplification, the dissociation curve provided by qPCR platforms, along with the analysis of qPCR product via agarose gel electrophoresis, greatly assists in further evaluating library quality.
- Create the following PCR mastermix on a cooling block.
Reagent | Stock concentration | Mix concentration | Volume per reaction |
---|---|---|---|
10x PCR Gold buffer | 10X | 1X | 2.5 µl |
MgCl2 Solution | 25 mM | 2.5 mM | 2.5 µl |
dNTPs Mix | 10 mM each | 0.08 mM each | 0.2 µl |
Forward (F) Primer | 10 μM | 0.4 μM | 1.0 µl |
Forward (R) Primer | 10 μM | 0.4 μM | 1.0 µl |
Sybr Green | 1.0 µl | ||
AmpliTaq GOLD DNA polymerase | 5 U/µl | 2.5 U | 0.5 µl |
ddH2O | 14.3 µl | ||
Total | 23 µl |
- Mix well and spin down mastermix.
- Aliquot 25 µl of the reaction to each well in the PCR plate/strip.
- Add 2 µl of 1:20 diluted library template to each well.
- Vortex and spin down the PCR mixture.
- Set up the qPCR program.
Step | Time | Repetition |
---|---|---|
95 ºC | 12 min | 1X |
- | - | - |
95 ºC | 20 sec | |
60 ºC | 30 sec | 40 X |
72 ºC | 40 sec | |
- | - | - |
Dissociation curve |
- Run qPCR products on agarose gel 2% using 5 µl qPCR product + 2 µl dye solution. Settings: 130V, 350A, 35 minutes.
2. PCR amplification
- Create the PCR mastermix on a cooling block.
Reagent | Stock concentration | Mix concentration | Volume per reaction |
---|---|---|---|
10x PCR Gold buffer | 10X | 1X | 5.0 µl |
MgCl2 Solution | 25 mM | 2.5 mM | 5.0 µl |
dNTPs Mix | 10 mM each | 0.08 mM each | 0.4 µl |
AmpliTaq GOLD DNA polymerase | 5 U/µl | 5 U | 1.0 µl |
ddH2O | 26.6 µl | ||
Total | 38 µl |
- Mix well and spin down mastermix.
- Aliquot 38 µl of the reaction to each well in the PCR plate/strip.
- Add 1 µl of each uniquely indexed primer to each well.
Reagent | Stock concentration | Mix concentration | Volume per reaction |
---|---|---|---|
Forward (F) Primer | 10 μM | 0.2 μM | 1.0 µl |
Forward (R) Primer | 10 μM | 0.2 μM | 1.0 µl |
Total | 2 µl |
- Add 10 µl of DNA library product to each well.
- Vortex and spin down the PCR mixture.
- Set up the qPCR program with adjusted number of cycles per library, as determined by the qPCR screening.
Step | Time | Repetition |
---|---|---|
95 ºC | 12 min | 1X |
- | - | - |
95 ºC | 20 sec | |
60 ºC | 30 sec | 7-19X |
72 ºC | 40 sec | |
- | - | - |
72 ºC | 5 min | 1X |
4 ºC | inf. | 1X |
3. Magnetic bead-based purification
The final indexed library product needs to be purified in order to get rid of the enzymes and buffers employed in the PCR amplification.
- Equilibrate the beads to room temperature for 30 min.
- Ensure the beads are fully resuspended by vortexing.
- Transfer 60 µl (~ 1.2 times the volume of the library) of beads to each well containing the indexed library and mix thoroughly by pipetting.
- Incubate the mixture for 5 minutes at room temperature.
- Place PCR strips/PCR plate on a magnetic rack and wait until the supernatant is clear.
- Discard the supernatant.
- Add 200 µl of 80% EtOH to each well. Discard the supernatant.
- Repeat step 7 and ensure that all residual ethanol is removed.
- Dry the beads for a maximum of 5 minutes.
- Add 35 µl of EBT buffer to each well and quick-spin the PCR strips/PCR plate.
- Incubate the mixture 10 minutes at 37°C (outside the magnet).
- Quick-spin the PCR strips/PCR plate.
- Place the PCR strips/PCR plate on a magnetic rack and wait until the supernatant is clear.
- Aspirate (slowly to avoid bead transfer) and dispense the supernatant (DNA libraries) to a new PCR strips/PCR plate.
- Transfer the purified DNA to a 200 µl LVL tube.